chapterthirteengeneexpressionregulation

chapterthirteengeneexpressionregulation内容摘要：

r Repressor (4 polymer) The negative regulation mechanism of the repressor cooperate with the positive regulation mechanism of the CAP control gene transcription of lac operon by kind and concentration of carbohydrate from the environment. regulation of transcribed termination in prokaryotic genes  5’ Dependent upon  factor 5’ Promoter Gene RNA polymerase Terminator new RNA  RNA polymerase 5’ 5’ 5’ coding strand template strand new RNA transcript model about transcription termination for independent to  factor G A C C G C C G C U G G C G G C A U U U UOH 3’ 5’ U U C G G 5’… GCCGCCAGUUCGGCUGGCGGCAUUUU…3’ RNA 5’… GCCGCCAGTTCGGCTGGCGGCATTTT… 3’ terminator  The RNA made from the DNA palindrome is selfplementary and so formed a internal hairpin structure followed by a few U bases.  The signals that terminates transcription are localized in the gene 3’ end.  A simple termination signal is a GC rich region that is a palindrome, followed by ATrich sequence. DNA Synthesis of tryptophan in E. coli O HO H2C COOH C Chorismic acid COOH NH2 Anthranilic acid Anthranilic acid synthetase CH2 N CH OH O P OH CH Indolglycerol phosphate Indoglycerol phosphate synthetase NH2 N CH CH2 COOH Tryptophan Tryptophan synthetase attenuation regulation mechanism of gene transcription of trp operon in L Trp operon R E D C B A p O attenuater The regulation mechanism of trp operon at a few tryptophans present or tryptophans absent L Inactive repressor R E D C B A p O whole mRNA at a lot of tryptophans present L Inactive repressor Trp + Repressor R E D C B A p O RNA polymerase or fragmentary mRNA M K A I F L K G 1 2 3 4 ribosome Try code RNA polymerase RNA DNA M K A I F L K G 1 3 4 ribosome Try code RNA polymerase 2 W W R DNA RNA tryptophans absent lot of tryptophans regulation of proteic translation in prokaryote autoregulation/autogenous control Protein mRNA DNA same mRNA 5’ 3’ started region antisene control Protein mRNA DNA 5’ 3’ started region Antisens RNA Section 4 Regulation of eukaryotic gene expression character of eukaryotic genomic structure character of expressional regulation of eukaryotic genes regulation of transcription for RNA pol I and RNA pol III regulation of transcriptional initiation for RNA pol II regulation of transcriptional termination for RNA pol II regulation of pasttranscription for RNA regulation of translation for protein character of eukaryotic genomic structure  The eukaryotic genome is very great.  The structure of eukaryotic genome is very plex.  There is only a gene in a transcription unit of eukaryotic genome.  There are a lot of repeat sequences in eukaryotic genome.  gene is discontinuous, there are noncoding sequences in the most eukaryotic gene. character of transcription regulation of eukaryotic genes three RNA polymerases in eukaryote  RNA polymerase Ⅰ ， 45srRNA(28S, 18S, )  RNA polymerase Ⅱ* ， hnRNA(mRNA), a part of snRNA  RNA polymerase Ⅲ ， 5srRNA, tRNA, a part of snRNA  The every RNA polymerase is consist of about 10 subunits.  The some subunits are in mon for every RNA polymerase , for example TATA boxbinding protein (TBP).  The some subunits are special for a RNA polymerase.  TFⅡ D is core of polymeraseⅡ .  TFⅡ D is consist of TBP and TBPrelated factor. structural character of active gene region  There are hypersensitive sites of DNaseⅠ in the flanking regions of active gene, near regulation protein binding sites. Gene coding region Promoter Silencer or Enhancer Silencer or Enhancer site site site site DNA RNA dsDNA supersolenoid chromatid chromosome solenoid chromatin nucleosomes transcription bubble RNA activity of gene structure 2 1 3 4 5 6  When gene is activated, topology structure of transcription region DNA in front of RNA polymerase is positive superhelix conformation,that one in back of of RNA polymerase is negative superhelix conformation. RNA polymerase negative superhelix positive superhelix GCGCGCGC  The negative superhelix conformation of DNA is propitious to form nucleosomes again, positive one is propitious to separate histone in nucleosomes  The methylation of CpG sequence in active gene flaking region is lower. Gene  The histons in active gene region change often as follows:  The richLys H1like histons are decreased.  The ability of DNA to form 30nm fasciculi is reduced  The instability of dimer H2AH2B is increased.  The dimer H2AH2B is prone to be replaced out from nucleosome.  The histons is prone to be modified, in result its structure bees instability.  H3 histon sulfhedryl is exposed out. The positive regulation is main in gene transcription regulation of eukaryotes  The most transcriptional regulation proteins are transcriptional activation proteins.  The affinity between RNA polymerase and pomoter in eukaryotes is very weaker or not.  RNA polymerase must depend on one or many activation proteins to bind with pomoter.  The positive regulation is universality in gene transcript。